|
Bio-Techne corporation
recombinant human his6-usp30 protein, cf Recombinant Human His6 Usp30 Protein, Cf, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Recombinant+Human+His6-USP30+Protein%2C+CF/bio-techne+corporation___e-582 Average 94 stars, based on 1 article reviews
recombinant human his6-usp30 protein, cf - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp usp30 hs00261902 m1 Gene Exp Usp30 Hs00261902 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Gene+Exp%2E+USP30%2C+Hs00261902_m1/pmc02438355-99-16--1 Average 85 stars, based on 1 article reviews
gene exp usp30 hs00261902 m1 - by Bioz Stars,
2026-10
85/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
anti usp30 Anti Usp30, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/USP30+Antibody/pmc10643470-339-50-51 Average 93 stars, based on 1 article reviews
anti usp30 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
OriGene
nm 010849 mouse tagged orf Nm 010849 Mouse Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Usp30+(NM_001033202)+Mouse+Tagged+ORF+Clone/pmc07724356-207-28-36 Average 90 stars, based on 1 article reviews
nm 010849 mouse tagged orf - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Addgene inc
hela parkin usp30 ![]() Hela Parkin Usp30, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Human+USP30+(1-517%2C+C77A%2C+MG-38-16)+(Plasmid+%23110749)/pmc08891576-92-0-12 Average 93 stars, based on 1 article reviews
hela parkin usp30 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Atlas Antibodies
prestige antibodies ![]() Prestige Antibodies, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Anti-USP30/pm40325251-480-9-13 Average 93 stars, based on 1 article reviews
prestige antibodies - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
human usp30 catalytic domain ![]() Human Usp30 Catalytic Domain, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Human+USP30+(64-502%2C+construct+13%2C+MG-26-82)+(Plasmid+%23110746)/bio_rxiv__2024__09__22__613429-169-6-10 Average 93 stars, based on 1 article reviews
human usp30 catalytic domain - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Proteintech
antibodies against usp30 ![]() Antibodies Against Usp30, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/beta+Amyloid+1-42+Antibody/pmc10757218-52-20-30 Average 95 stars, based on 1 article reviews
antibodies against usp30 - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
MISSION Therapeutics
usp30 inhibitors ![]() Usp30 Inhibitors, supplied by MISSION Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/usp30+inhibitors/pmc12063660-151-33-40 Average 90 stars, based on 1 article reviews
usp30 inhibitors - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
OriGene
50 accuuugaauagaguguuaucu ggg 30 ![]() 50 Accuuugaauagaguguuaucu Ggg 30, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/USP30+Human+siRNA+Oligo+Duplex/pm24849047-227-24-23 Average 90 stars, based on 1 article reviews
50 accuuugaauagaguguuaucu ggg 30 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
R&D Systems
usp30 ![]() Usp30, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Recombinant+Human+His6-USP30+Protein%2C+CF/pmc11825904-293-14-15 Average 93 stars, based on 1 article reviews
usp30 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp usp30 dm01796115 g1 ![]() Gene Exp Usp30 Dm01796115 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+usp30+catalytic+domain/Gene+Exp%2E+Usp30%2C+Dm01796115_g1/pm24896179-399-15-6 Average 86 stars, based on 1 article reviews
gene exp usp30 dm01796115 g1 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: PINK1/Parkin-dependent mitophagy induces apoptosis during mitochondrial stress (A) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela (no Parkin) cells and Hela Parkin cells after the AO (Antimycin A+ oligomycin) treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control. These are representative figures from three independent experiments (B) . Cell viability assay of Hela (no Parkin) cells and Hela Parkin cells after AO treatment. Cells were treated with AO at 5 ug/ml for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using 544 nm excitation and 590 nm emission wavelength. It is a representative figure from three independent experiments (C) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela Parkin cells and Hela Parkin with PINK1 KO cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control (D) . Cell viability assay of Hela Parkin cells and Hela Parkin with USP30 overexpression cells after AO treatment with or without ST-539. Cells were treated with AO at 5 ug/ml w/o 10 ug/ml ST-539 for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength (E) . Western blot analysis of mitophagy proteins and the pro-apoptosis signal in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment w/o ST-539. Cells were treated with AO at 5 ug/ml w/o 10 ug/ml ST-539 for 0, 3, and 6 h. Beta Actin served as the loading control (F) . Cell viability assay of Hela ATG5 knockout cells, Hela ATG5 knockout Parkin cells, and Hela ATG5 knockout Parkin USP30 cells after AO treatment. Cells were treated with AO at 5 ug/ml for 24 h and then incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength.
Article Snippet:
Techniques: Western Blot, Control, Viability Assay, Incubation, Fluorescence, Over Expression, Knock-Out
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: USP30 upregulates AKT/mTOR signal (A) . Western blot analysis of AKT/mTOR pathway proteins in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, 6, and 9 h. Beta Actin served as the loading control. 2 (B) . Western blot analysis of AKT signal in Hela Parkin cells and Hela Parkin with USP30 overexpression cells after the AO treatment w/o ST-539. Cells were treated with AO at 5 ug/ml w/o ST-539 for 0, 3, and 6 h. Beta Actin served as the loading control. 2 (C) . Western blot analysis of AKT and cleaved PARP in Hela Parkin and Hela Parkin USP30 cells after the AO treatment w/o chloroquine. Cells were treated with AO at 5 ug/ml for 0, 3, and 6 h with DMSO or 10 uM chloroquine to inhibit autophagy/mitophagy. Beta Actin served as the loading control. 2 (D) . Western blot analysis of AKT and cleaved PARP in Hela ATG5 knockout Parkin and Hela ATG5 knockout Parkin USP30 cells after the AO treatment. Cells were treated with AO at 5 ug/ml for 0, 3, and 6 h. Beta Actin served as the loading control.
Article Snippet:
Techniques: Western Blot, Over Expression, Control, Knock-Out
Journal: Frontiers in Pharmacology
Article Title: The Mitochondrial Deubiquitinase USP30 Regulates AKT/mTOR Signaling
doi: 10.3389/fphar.2022.816551
Figure Lengend Snippet: USP30 in cancer treatment. 3 (A) . Cell viability assay of Hela Parkin USP30 cells after AKT/mTOR inhibitors treatment w/o ST. Cells were treated with 10 uM MK2206 or 10uM Rapamycin or 1uM Torin1 for 48 h with DMSO or 10 ug/ml ST-539 and then incubated with resazurin for 2 h. Fluorescence was read using 544 nm excitation and 590 nm emission wavelength. 3 (B) . Cell viability assay on Jurkat T cells after 72 h MK2206 treatment with ST. Cells were treated with MK2206 and ST in the concentration gradient manner for 72 h. After the treatment, cells were incubated with resazurin for 2 h. Fluorescence was read using544 nm excitation and 590 nm emission wavelength. Each dot is the mean value of three biologically independent experiments. Trend lines are non-linear regression fitting curves. 3 (C) . Western blot analysis of AKT, mitophagy, and pro-apoptosis signal in Jurkat T cells treated with DMSO, MK2206, or ST. Cells were treated with DMSO, MK2206, ST, or MK220 + ST for 24 h. Beta Actin served as the loading control.
Article Snippet:
Techniques: Viability Assay, Incubation, Fluorescence, Concentration Assay, Western Blot, Control
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , USP30 antagonizes Pink1/Parkin-mediated mitophagy. b , Chemical structures of a covalent and a non-covalent USP30 inhibitor. Inhibition of USP30 to enhance mitochondrial quality control is explored clinically as therapeutic strategy for Parkinson’s and kidney diseases. c , Crystal structure of human USP30 obtained with a previously engineered construct as Ub-PA complex (PDB: 5OHK). USP subdomains are shown in different colors. d , Architecture of full-length human USP30, previously used construct c1 (named c13 in ) and here described USP30 chimera ch3. See Supplementary Fig. 2 for other chimeras. e , AlphaFold-predicted model of USP30 c1 , crystal structures of the catalytic domains of USP14 (PDB: 2AYN) and USP35 (PDB: 5TXK), and AlphaFold-predicted model of USP30 chimera ch3. Regions used for grafting are shown in corresponding colors. f , Catalytic efficiencies of indicated USP30 constructs, determined from Ubiquitin-RhoG (Ub-RhoG) cleavage assays. See Supplementary Fig. 3 for raw data. Mean ± s.e.m. g , Stability assessment of USP30 constructs in their apo states derived from thermal shift assays. Tm , protein melting temperature. h , Changes in protein stability upon binding to the Ubiquitin probe Ub-PA. Mean ± s.d. (N=3). i , Gel-based Ub-PA binding assay. j , Crystal structure of USP30 ch3 ∼Ub-PA. See for statistics. k , Structure of NK036, a solubility-enhanced derivative of Compound 39. l , Inhibitory potencies of NK036 for indicated USP30 constructs. IC50 values are given as mean ± s.e.m. m , Protein stability of indicated USP30 constructs in the presence of NK036.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Inhibition, Control, Construct, Ubiquitin Proteomics, Derivative Assay, Binding Assay, Solubility
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Cartoon representation of the crystal structure of USP30 ch3 bound to NK036. The compound is shown under an orange surface. b , Composite omit electron density map of NK036 in chain A (2mFO-DFC, contoured at 1σ, covering all atoms of the compound). c , Structure as in A with surface representation of USP30. d , Compound binding site highlighting typical USP regions involved in binding to NK036. e , Close-up view of the compound binding site highlighting key residues involved in H-bonding. f , Close-up view of the USP30 hydrophobic patch engaging the fluorobenzoyl moiety of the compound. g , Close-up view of hydrophobic interactions of the phenylalanine group of the compound. h , Close-up view of the benzenesulfonamide moiety of the compound engaged by USP30 residues.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Binding Assay
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Cartoon representation of the crystal structure of USP30 bound to NK036. The compound is shown under an orange surface. b , Structure of USP30∼Ub-PA complex (PDB: 5OHK). Ubiquitin is shown under a yellow surface. c , Superposition of panels a and b. d , Close-up view of the compound binding site. Catalytic triad residues of USP30 and Leu73 of Ubiquitin are labeled. The conformational change of the USP30 switching loop is indicated. e , Close-up view on the engagement of the Ubiquitin Leu73 side chain by USP30, with residues forming the hydrophobic pocket highlighted. f , Superposition of the structures, focused on the Leu73 binding pocket showing its occupation by the fluorobenzoyl group of NK036. g-h , Close-up views of the conformational changes of the switching loop, focusing on entry of the cryptic pocket within the thumb subdomain (g) and the anchoring of the switching loop on the α5 helix (h). Putative movements of residues are indicated with arrows. See also Supplementary Movie 1 , in which the equivalent transition is shown based on the Lys6-diubiquitin-bound structure of USP30 (PDB: 5OHP).
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Ubiquitin Proteomics, Binding Assay, Labeling
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Sequence alignment of indicated human USP DUBs. Arrows indicate the unique Leu328 and Phe453 residues in USP30. b , Close-up view of the compound binding site. c , Superposition with indicated USP DUB structures in complex with inhibitors (PDB: 5N9R, 6IIN, 6GH9), highlighting how equivalent Phe and Tyr residues in other human USP DUBs interfere with compound binding. d , Catalytic activities of indicated wild-type (WT) and mutant USP30 proteins, assessed by Ub-RhoG cleavage. Mean ± s.e.m. e , Inhibitory potencies of NK036, pre-incubated with indicated USP30 proteins for 1.5 h, determined from Ub-RhoG cleavage assays. IC50 values are given as mean ± s.e.m. f , Protein stability of indicated USP30 proteins in the presence of 20 µM NK036. Δ Tm was calculated as Tm of the compound-bound sample subtracted from Tm of the respective apo protein. Mean ± s.d. (N=3). g , Inhibitory potencies of Compound 39, determined as in e. h , Protein stability assessment in the presence of Compound 39, determined as in f. i , Probe competition assay. USP30 and inhibitors were preincubated, followed by addition of Ub-PA, and analysis of samples by SDS-PAGE and Coomassie staining. j , Cellular probe competition assay. HEK293 cells were treated with indicated compounds. Lysates were then incubated with ubiquitin probe where indicated and analyzed by western blot. The asterisk denotes an unspecific band. k , Cellular assessment of USP30 inhibition mechanism. C-terminally Flag-tagged USP30 (WT or compound-resistant mutation F453Y) was overexpressed in HEK293 cells. Cells were analyzed as described in panel j.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Sequencing, Binding Assay, Mutagenesis, Incubation, Competitive Binding Assay, SDS Page, Staining, Ubiquitin Proteomics, Western Blot, Inhibition
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a-g , Cartoon representations of human USP-family deubiquitinase catalytic domains in complex with indicated small molecule inhibitors. Compounds are shown as both sticks and transparent surfaces. Structural elements of DUBs are labeled and PDB codes of structures are given. 44,45,48,52-54 The Leu73 Ubiquitin binding site is shown with an arrow when engaged by compounds. h , Comparison of USP30 inhibition by NK036 to other DUB inhibitors. Superposition of the structure of USP30+NK036 on other structures shown in panels a-f. Compounds are shown as surfaces and are labeled. All USP cartoons except USP30 are semitransparent.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Labeling, Ubiquitin Proteomics, Binding Assay, Comparison, Inhibition
Journal: bioRxiv
Article Title: Chimeric deubiquitinase engineering reveals structural basis for specific inhibition of USP30 and a framework for DUB ligandability
doi: 10.1101/2024.09.22.613429
Figure Lengend Snippet: a , Schematic of a Ubiquitin-bound USP DUB. Structural elements are labeled. b , Schematic of USP30 in complex with an inhibitor of the benzenesulfonamide scaffold, occupying the Ubiquitin Leu73 pocket (sand), the cryptic pocket (green) and the cleft towards the S1 Ubiquitin binding site (blue) with shown chemical moieties. c , Schematic of DUB inhibition with compounds being composed of a hotspot anchor element (occupying the Ubiquitin Leu73 pocket) and one or two specificity extensions (occupying the shown other USP DUB structural elements). Compounds featuring the respective extensions are named together with their cognate DUBs. 44,46,48,53- 56 See Supplementary Fig. 8 for structural superpositions focused on the Leu73 binding pocket. d , Chemical structures of specific DUB inhibitors. Chemical motifs occupying the distinct binding sites are colored according to panel c. The hotspot anchor motifs shared by all are highlighted.
Article Snippet: The following sequences were used: Codon-optimized
Techniques: Ubiquitin Proteomics, Labeling, Binding Assay, Inhibition
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: Primer sequences for qRT‐PCR.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques:
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: miR‐137‐5p was significantly downregulated in AD (Alzheimer's disease) patient serum. qRT‐PCR analysis of (A) miR‐137‐5p and (B) USP30 (ubiquitin‐specific peptidase 30) levels in serum samples from AD patients ( n = 47) and healthy controls ( n = 43). (C) The correlation between miR‐137‐5p and USP30 levels in AD patients was evaluated using Spearman's correlation analysis. (D) The predicted binding site in the 3′UTR (untranslated region) of USP30 for miR‐137‐5p. (E) Dual‐luciferase reporter system analyzing the targeting relationship between miR‐137‐5p and USP30. *** p < 0.001.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques: Quantitative RT-PCR, Binding Assay, Luciferase
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: miR‐137‐5p mimics rescues Aβ 1–42 ‐induced apoptosis in vitro. (A) qRT‐PCR analysis of miR‐137‐5p level in SH‐SY5Y cells after transfection of miR‐137‐5p mimics and mimics NC for 24 h, *** p < 0.001. (B, C) Flow cytometry analysis of cell apoptosis after the treatment of 10 μM Aβ 1–42 for 24 h; * represents compared with control group, *** p < 0.001; @ represents compared with mimics NC + Aβ 1–42 group, @@ p < 0.01. (D) Western blotting analysis of the protein level of USP30 (ubiquitin‐specific peptidase 30) in Aβ 1–42 ‐treated cells.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques: In Vitro, Quantitative RT-PCR, Transfection, Flow Cytometry, Western Blot
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: USP30 (ubiquitin‐specific peptidase 30) overexpression impeded the protective effect of miR‐137‐5p on Aβ 1–42 ‐induced cytotoxicity. (A) qRT‐PCR and (B) Western blot analysis of USP30 mRNA (messenger RNA) and protein levels in SH‐SY5Y cells after transfection with USP30 vector or vector control, *** p < 0.001. (C, D) Flow cytometry analysis of cell apoptosis in each group, * represents compared with mimic NC + vector, *** p < 0.001; # represents compared with mimic NC + vector + Aβ 1–42 , ## p < 0.01; @ represents compared with miR‐137‐5p mimic + mimics NC + Aβ 1–42 group, @@ p < 0.01.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques: Over Expression, Quantitative RT-PCR, Western Blot, Transfection, Plasmid Preparation, Flow Cytometry
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: miR‐137‐5p improves spatial memory and cognitive deficit in AD (Alzheimer's disease) mice by downregulating USP30 (ubiquitin‐specific peptidase 30). (A) Schematic diagram of interventions in animal experiments. Morris water maze test analysis of (B) movement time, (C) platform crossing time, and (D) target quadrant dwell time of mice in water maze ( n = 6). (E) H&E (hematoxylin–eosin) staining analysis of the pathological changes in mice hippocampus and cortex tissues (magnification: ×200, scale bar: 100 μm). * represents compared with sham group, ** p < 0.01, *** p < 0.001. # represents compared with AD group, ## p < 0.01. @ represents compared with AD + miR‐137‐5p agomir group, @@ p < 0.01.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques: Staining
Journal: Animal Models and Experimental Medicine
Article Title: miRNA ‐137‐5p improves spatial memory and cognition in Alzheimer's mice by targeting ubiquitin‐specific peptidase 30
doi: 10.1002/ame2.12368
Figure Lengend Snippet: miR‐137‐5p rescues cortex and hippocampus neuron damage. (A) Representative images of Nissl staining for cortex and hippocampus neurons (magnification: ×200, scale bar: 100 μm). (B) TUNEL (TdT‐mediated dUTP nick‐end labeling) assay analysis of neuronal apoptosis in cortex and hippocampus regions of AD (Alzheimer's disease) mice (magnification: ×400, scale bar: 50 μm). (C–F) Western blot analysis of the protein levels of Bax, Bcl‐2, USP30 (ubiquitin‐specific peptidase 30), Aβ 1–42 , and p‐Tau S396 in cortex and hippocampus regions of AD mice.
Article Snippet: Then, the PVDF membranes were blocked using 5% skim milk at 25°C for 60 min and subsequently exposed to primary
Techniques: Staining, TUNEL Assay, End Labeling, Western Blot
Journal: Nature Communications
Article Title: Design of quinoline SARS-CoV-2 papain-like protease inhibitors as oral antiviral drug candidates
doi: 10.1038/s41467-025-56902-x
Figure Lengend Snippet: a Differential scanning fluorimetry assay of Jun13296 in stabilizing SARS-CoV-2 PL pro . Jun12682 was included as a positive control for comparison. Data from Jun12682 is the mean of two repeats, and data from Jun13296 is the mean ± standard deviation of three technical repeats. b K i plot of Jun13296 in inhibiting SARS-CoV-2 PL pro hydrolysis of ISG15-AMC. c K i plot of Jun13296 in inhibiting SARS-CoV-2 PL pro hydrolysis of Ub-AMC. d Counter screening of Jun 13296 against host proteases USP2, USP7, USP8, USP14, USP15, USP30, UCH-L1, cathepsin B, cathepsin K, calpain-1, trypsin, and caspase 3. Data in ( d ) are presented as mean ± standard deviation of two technical repeats. Source data are provided as a file.
Article Snippet: E-520-025), 500 nM USP14 (ProSci, 91-171), 1 nM USP15 (R&D systems, E594), 20 nM
Techniques: Fluorimetry Assay, Positive Control, Comparison, Standard Deviation